Stem-loop sequence hsa-mir-4525

AccessionMI0016892 (change log)
Symbol HGNC:MIR4525
DescriptionHomo sapiens miR-4525 stem-loop
Stem-loop
   g    a  -     u               --g ug    
5'  ucag gg gggga gugcaugcugguugg   g  ggc 
    |||| || ||||| |||||||||||||||   |  || u
3'  aguc cc ccccu cacgugcgacuaacc   u  ccg 
   a    -  a     u               agg gu    
Get sequence
Deep sequencing
411 reads, 4.65 reads per million, 86 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 82668233-82668307 [-]
intergenic
Database links

Mature sequence hsa-miR-4525

Accession MIMAT0019064
Sequence

7 - 

ggggggaugugcaugcugguu

 - 27

Get sequence
Deep sequencing208 reads, 41 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).