Stem-loop sequence hsa-mir-4524b

AccessionMI0019114 (change log)
Symbol HGNC:MIR4524B
DescriptionHomo sapiens miR-4524b stem-loop
Gene family MIPF0001330; mir-4524
Stem-loop
   uagcug     ----aug g      u   g           a           aaa  a 
5'       ggugg       u uucuuu gaa gauagcagcau agccugucuca   ua u
         |||||       | |||||| ||| ||||||||||| |||||||||||   ||  
3'       ucacu       a gagaaa cuu cuaucgucgua uuggacagagu   gu u
   ---cug     aauggga g      c   g           c           gac  c 
Get sequence
Deep sequencing
15 reads, 45.5 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 69099542-69099656 [+]
antisense
OTTHUMT00000431480 ; RP11-879D6.1-001; intron 3
ENST00000569074 ; CASC17-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-4524b
hsa-mir-4524bchr17: 69099542-69099656 [+]
hsa-mir-4524achr17: 69099564-69099632 [-]
Database links

Mature sequence hsa-miR-4524b-5p

Accession MIMAT0022255
Sequence

29 - 

auagcagcauaagccugucuc

 - 49

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; SOLiD [1]
Predicted targets

Mature sequence hsa-miR-4524b-3p

Accession MIMAT0022256
Sequence

66 - 

gagacagguucaugcugcua

 - 85

Get sequence
Deep sequencing5 reads, 2 experiments
Evidence experimental; SOLiD [1]
Predicted targets

References

1
PMID:21895886 "Deep sequencing of short RNAs reveals novel microRNAs in minor salivary glands of patients with Sjogren's syndrome" Tandon M, Gallo A, Jang SI, Illei GG, Alevizos I Oral Dis. 18:127-131(2012).