Stem-loop sequence hsa-mir-4524a

AccessionMI0016891 (change log)
Previous IDshsa-mir-4524
Symbol HGNC:MIR4524A
DescriptionHomo sapiens miR-4524a stem-loop
Gene family MIPF0001330; mir-4524
Literature search

1 open access papers mention hsa-mir-4524a
(1 sentences)

Stem-loop
   -   c             a         cugcag 
5'  gaa gauagcagcauga ccugucuca      a
    ||| ||||||||||||| |||||||||       
3'  cuu cuaucgucguauu ggacagagu      a
   a   c             c         uuuauu 
Get sequence
Deep sequencing
663 reads, 0 reads per million, 90 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 69099564-69099632 [-]
sense
OTTHUMT00000431480 ; RP11-879D6.1-001; intron 3
ENST00000569074 ; CASC17-001; intron 3
Clustered miRNAs
< 10kb from hsa-mir-4524a
hsa-mir-4524achr17: 69099564-69099632 [-]
hsa-mir-4524bchr17: 69099542-69099656 [+]
Database links

Mature sequence hsa-miR-4524a-5p

Accession MIMAT0019062
Previous IDshsa-miR-4524
Sequence

6 - 

auagcagcaugaaccugucuca

 - 27

Get sequence
Deep sequencing196 reads, 51 experiments
Evidence experimental; Illumina [1-2,4]
Database links
Predicted targets

Mature sequence hsa-miR-4524a-3p

Accession MIMAT0019063
Previous IDshsa-miR-4524*
Sequence

42 - 

ugagacaggcuuaugcugcuau

 - 63

Get sequence
Deep sequencing461 reads, 76 experiments
Evidence experimental; Illumina [1-2,4]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21911355 "miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades" Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N Nucleic Acids Res. 40:37-52(2012).
4
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).