Stem-loop sequence hsa-mir-4523

AccessionMI0016890 (change log)
Symbol HGNC:MIR4523
DescriptionHomo sapiens miR-4523 stem-loop
Gene family MIPF0002104; mir-4523
Stem-loop
   g       -   a --a             g gag 
5'  cggggga ccg g   gggccucggcugu u   g
    ||||||| ||| |   ||||||||||||| |   a
3'  gcccccu ggc c   cccggagccggcg a   c
   a       u   - ggg             g gau 
Get sequence
Deep sequencing
213 reads, 0 reads per million, 52 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 29390662-29390730 [+]
sense
OTTHUMT00000445171 ; RP11-848P1.9-005; intron 1
ENST00000580053 ; RP11-848P1.9-005; intron 1
Database links

Mature sequence hsa-miR-4523

Accession MIMAT0019061
Sequence

7 - 

gaccgagagggccucggcugu

 - 27

Get sequence
Deep sequencing187 reads, 41 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).