Stem-loop sequence hsa-mir-4522

AccessionMI0016889 (change log)
Symbol HGNC:MIR4522
DescriptionHomo sapiens miR-4522 stem-loop
Literature search

2 open access papers mention hsa-mir-4522
(6 sentences)

Stem-loop
   --- c      ug  uggg     c     g    -------au     c 
5'    g gggcgu  cc    ggccu gcagg ggag         ccagc c
      | ||||||  ||    ||||| ||||| ||||         |||||  
3'    c ucugcg  gg    ccgga ugucc ucuc         ggucg a
   ggu u      gu  ----     -     g    agucgccuu     g 
Get sequence
Deep sequencing
57 reads, 0 reads per million, 38 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 27293910-27293996 [-]
sense
OTTHUMT00000448617 ; SEZ6-003; intron 3
OTTHUMT00000397478 ; SEZ6-006; intron 3
OTTHUMT00000397474 ; SEZ6-001; intron 4
OTTHUMT00000397475 ; SEZ6-002; intron 4
OTTHUMT00000397483 ; SEZ6-012; intron 4
ENST00000540632 ; SEZ6-003; intron 3
ENST00000540419 ; SEZ6-006; intron 3
ENST00000360295 ; SEZ6-001; intron 4
ENST00000317338 ; SEZ6-002; intron 4
ENST00000442608 ; SEZ6-012; intron 4
ENST00000335960 ; SEZ6-201; intron 4
antisense
OTTHUMT00000446987 ; PIPOX-012; intron 1
OTTHUMT00000446820 ; PIPOX-011; intron 2
OTTHUMT00000446988 ; PIPOX-013; intron 2
OTTHUMT00000446989 ; PIPOX-010; intron 2
OTTHUMT00000446990 ; PIPOX-003; intron 2
ENST00000580383 ; PIPOX-012; intron 1
ENST00000580241 ; PIPOX-011; intron 2
ENST00000583215 ; PIPOX-013; intron 2
ENST00000578748 ; PIPOX-010; intron 2
ENST00000577182 ; PIPOX-003; intron 2
Database links

Mature sequence hsa-miR-4522

Accession MIMAT0019060
Sequence

55 - 

ugacucugccuguaggccggu

 - 75

Get sequence
Deep sequencing49 reads, 37 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).