Stem-loop sequence hsa-mir-4520-1

AccessionMI0016886 (change log)
Previous IDshsa-mir-4520a
Symbol HGNC:MIR4520-1
DescriptionHomo sapiens miR-4520-1 stem-loop
Gene family MIPF0001272; mir-4520
Stem-loop
   -gugugcca                       ag 
5'          ccugcguguuuucuguccaaauc  a
            |||||||||||||||||||||||  a
3'          ggacgcacaaaagacagguuuag  a
   aaggaagaa                       ga 
Get sequence
Deep sequencing
457 reads, 0 reads per million, 47 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 6655440-6655509 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-4520-1
hsa-mir-4520-2chr17: 6655449-6655502 [+]
hsa-mir-4520-1chr17: 6655440-6655509 [-]
Database links

Mature sequence hsa-miR-4520-5p

Accession MIMAT0019235
Previous IDshsa-miR-4520a-5p
Sequence

9 - 

ccugcguguuuucuguccaa

 - 28

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; Illumina [1]

Mature sequence hsa-miR-4520-3p

Accession MIMAT0019057
Previous IDshsa-miR-4520a-3p
Sequence

42 - 

uuggacagaaaacacgcaggaa

 - 63

Get sequence
Deep sequencing450 reads, 43 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21807764 "Deep sequencing of small RNAs from human skin reveals major alterations in the psoriasis miRNAome" Joyce CE, Zhou X, Xia J, Ryan C, Thrash B, Menter A, Zhang W, Bowcock AM Hum Mol Genet. 20:4025-4040(2011).