Stem-loop sequence hsa-mir-4520-2

AccessionMI0017358 (change log)
Previous IDshsa-mir-4520b
Symbol HGNC:MIR4520-2
DescriptionHomo sapiens miR-4520-2 stem-loop
Gene family MIPF0001272; mir-4520
Stem-loop
   -                       cu 
5'  ccugcguguuuucuguccaaauc  u
    |||||||||||||||||||||||  u
3'  ggacgcacaaaagacagguuuag  u
   u                       uc 
Get sequence
Deep sequencing
366 reads, 0 reads per million, 34 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr17: 6655449-6655502 [+]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-4520-2
hsa-mir-4520-1chr17: 6655440-6655509 [-]
hsa-mir-4520-2chr17: 6655449-6655502 [+]
Database links

Mature sequence hsa-miR-4520-5p

Accession MIMAT0019235
Previous IDshsa-miR-4520a-5p
Sequence

1 - 

ccugcguguuuucuguccaa

 - 20

Get sequence
Deep sequencing9 reads, 7 experiments
Evidence experimental; Illumina [1]

Mature sequence hsa-miR-4520-2-3p

Accession MIMAT0020300
Previous IDshsa-miR-4520b-3p
Sequence

33 - 

uuuggacagaaaacacgcaggu

 - 54

Get sequence
Deep sequencing363 reads, 33 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).