Stem-loop sequence hsa-mir-4518

AccessionMI0016884 (change log)
Symbol HGNC:MIR4518
DescriptionHomo sapiens miR-4518 stem-loop
Literature search

1 open access papers mention hsa-mir-4518
(1 sentences)

Stem-loop
   u     ---aaa  ug u gg   g   ag   u   ug    g 
5'  ggggg      ag  c g  auu auu  uga guc  cugg g
    |||||      ||  | |  ||| |||  ||| |||  ||||  
3'  ccccc      uc  g c  uag uag  acu cgg  ggcc a
   u     gaagag  gu u aa   -   gg   -   --    a 
Get sequence
Deep sequencing
99 reads, 2.56 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 30503919-30504001 [+]
sense
OTTHUMT00000434512 ; ITGAL-009; intron 2
OTTHUMT00000434517 ; ITGAL-004; intron 2
OTTHUMT00000434521 ; ITGAL-016; intron 2
OTTHUMT00000434522 ; ITGAL-017; intron 2
OTTHUMT00000434511 ; ITGAL-002; intron 9
OTTHUMT00000434508 ; ITGAL-001; intron 11
ENST00000568926 ; ITGAL-009; intron 2
ENST00000433423 ; ITGAL-004; intron 2
ENST00000568012 ; ITGAL-016; intron 2
ENST00000564935 ; ITGAL-017; intron 2
ENST00000358164 ; ITGAL-002; intron 9
ENST00000356798 ; ITGAL-001; intron 11
Database links

Mature sequence hsa-miR-4518

Accession MIMAT0019055
Sequence

50 - 

gcucagggaugauaacugugcugaga

 - 75

Get sequence
Deep sequencing56 reads, 17 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).