Stem-loop sequence hsa-mir-4517

AccessionMI0016883 (change log)
Symbol HGNC:MIR4517
DescriptionHomo sapiens miR-4517 stem-loop
Literature search

1 open access papers mention hsa-mir-4517
(1 sentences)

Stem-loop
   a   aa    g  ga  cu    -   ga  ag      a 
5'  ggu  auau au  aa  caca gcu  gg  cuuagc a
    |||  |||| ||  ||  |||| |||  ||  |||||| g
3'  ucg  ugug ug  uu  gugu cga  cc  gaaucg u
   g   -g    g  gg  -u    u   ga  -g      a 
Get sequence
Deep sequencing
3323 reads, 10.5 reads per million, 76 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr16: 28958583-28958661 [+]
intergenic
Database links

Mature sequence hsa-miR-4517

Accession MIMAT0019054
Sequence

5 - 

aaauaugaugaaacucacagcugag

 - 29

Get sequence
Deep sequencing3319 reads, 75 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).