Stem-loop sequence hsa-mir-4513

AccessionMI0016879 (change log)
Symbol HGNC:MIR4513
DescriptionHomo sapiens miR-4513 stem-loop
Literature search

4 open access papers mention hsa-mir-4513
(5 sentences)

Stem-loop
   a    -             -  cgg    a    cau   c gu 
5'  uucu agguggggagacu ga   cugg ggcc   aag u  c
    |||| ||||||||||||| ||   |||| ||||   ||| |   
3'  aaga uucaccccucugg cu   gacc ccgg   uuc a  u
   c    c             u  uua    c    --c   a aa 
Get sequence
Deep sequencing
36 reads, 16.7 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 74788672-74788757 [-]
antisense
OTTHUMT00000419664 ; RP11-10O17.3-001; intron 3
ENST00000562869 ; RP11-10O17.3-001; intron 3
Database links

Mature sequence hsa-miR-4513

Accession MIMAT0019050
Sequence

14 - 

agacugacggcuggaggcccau

 - 35

Get sequence
Deep sequencing22 reads, 9 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).