Stem-loop sequence hsa-mir-4512

AccessionMI0016878 (change log)
Symbol HGNC:MIR4512
DescriptionHomo sapiens miR-4512 stem-loop
Literature search

2 open access papers mention hsa-mir-4512
(2 sentences)

Stem-loop
   c      c    a          a  uc     uaca 
5'  ucagcc gggc auauagugag cc  gucuc    a
    |||||| |||| |||||||||| ||  |||||    a
3'  ggucgg cccg uaugucacuc gg  cagag    a
   a      a    c          c  ga     uuaa 
Get sequence
Deep sequencing
417 reads, 12 reads per million, 92 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 66496958-66497034 [-]
sense
OTTHUMT00000329307 ; MEGF11-001; intron 1
OTTHUMT00000256882 ; MEGF11-002; intron 1
ENST00000409699 ; MEGF11-001; intron 1
ENST00000288745 ; MEGF11-002; intron 1
ENST00000422354 ; MEGF11-204; intron 1
ENST00000395625 ; MEGF11-203; intron 1
ENST00000395614 ; MEGF11-202; intron 1
ENST00000360698 ; MEGF11-201; intron 1
Database links

Mature sequence hsa-miR-4512

Accession MIMAT0019049
Sequence

49 - 

cagggccucacuguaucgccca

 - 70

Get sequence
Deep sequencing182 reads, 56 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).