Stem-loop sequence hsa-mir-4511

AccessionMI0016877 (change log)
Symbol HGNC:MIR4511
DescriptionHomo sapiens miR-4511 stem-loop
Literature search

2 open access papers mention hsa-mir-4511
(3 sentences)

Stem-loop
   a                                    ca uc 
5'  aaaaaaagggaaagaagaacuguugcauuugcccug  c  a
    ||||||||||||||||||||||||||||||||||||  |  g
3'  uuuuuuucccuuucuucuugauaacguaaaugggac  g  u
   a                                    ac uu 
Get sequence
Deep sequencing
230 reads, 6.06 reads per million, 66 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr15: 65719246-65719332 [-]
intergenic
Database links

Mature sequence hsa-miR-4511

Accession MIMAT0019048
Sequence

15 - 

gaagaacuguugcauuugcccu

 - 36

Get sequence
Deep sequencing173 reads, 48 experiments
Evidence experimental; Illumina [1-2], qPCR [2]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).