Stem-loop sequence hsa-mir-4506

AccessionMI0016869 (change log)
Symbol HGNC:MIR4506
DescriptionHomo sapiens miR-4506 stem-loop
Literature search

1 open access papers mention hsa-mir-4506
(1 sentences)

Stem-loop
   u    u  -   a            gg    ---  uu  g 
5'  ggcc cu gcc ucagaccaucug  uuca   ag  ug c
    |||| || ||| ||||||||||||  ||||   ||  ||  
3'  cugg ga cgg agucuggugggu  aagu   uc  ac u
   u    u  a   -            -a    auu  -u  c 
Get sequence
Deep sequencing
67 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 93948226-93948302 [-]
antisense
OTTHUMT00000074288 ; UNC79-002; intron 4
OTTHUMT00000412765 ; UNC79-003; intron 4
OTTHUMT00000074289 ; UNC79-001; intron 4
OTTHUMT00000412766 ; UNC79-006; intron 4
ENST00000256339 ; UNC79-002; intron 4
ENST00000555664 ; UNC79-003; intron 4
ENST00000553484 ; UNC79-001; intron 4
ENST00000393151 ; UNC79-006; intron 4
Database links

Mature sequence hsa-miR-4506

Accession MIMAT0019042
Sequence

51 - 

aaauggguggucugaggcaa

 - 70

Get sequence
Deep sequencing55 reads, 21 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).