Stem-loop sequence hsa-mir-4503

AccessionMI0016866 (change log)
Symbol HGNC:MIR4503
DescriptionHomo sapiens miR-4503 stem-loop
Stem-loop
   a                             uuu   u   aa 
5'  caauguagauauuuaagcaggaaauagaa   aca aua  u
    |||||||||||||||||||||||||||||   ||| |||   
3'  guuacaucuauaaauucguccuuuaucuu   ugu uau  u
   c                             ---   u   cu 
Get sequence
Deep sequencing
57 reads, 119 reads per million, 36 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr14: 36952309-36952391 [-]
sense
OTTHUMT00000376215 ; RP11-896J10.3-001; intron 2
OTTHUMT00000376217 ; SFTA3-001; intron 2
OTTHUMT00000376218 ; SFTA3-009; intron 2
OTTHUMT00000376219 ; SFTA3-002; intron 2
OTTHUMT00000376220 ; SFTA3-006; intron 2
OTTHUMT00000376221 ; SFTA3-008; intron 2
OTTHUMT00000376223 ; SFTA3-007; intron 2
OTTHUMT00000376222 ; SFTA3-005; intron 3
ENST00000521945 ; RP11-896J10.3-001; intron 2
ENST00000518529 ; SFTA3-001; intron 2
ENST00000518002 ; SFTA3-009; intron 2
ENST00000521114 ; SFTA3-002; intron 2
ENST00000518987 ; SFTA3-006; intron 2
ENST00000524122 ; SFTA3-008; intron 2
ENST00000418548 ; SFTA3-007; intron 2
ENST00000518446 ; SFTA3-005; intron 3
Database links

Mature sequence hsa-miR-4503

Accession MIMAT0019039
Sequence

13 - 

uuuaagcaggaaauagaauuua

 - 34

Get sequence
Deep sequencing15 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).