Stem-loop sequence hsa-mir-449c

AccessionMI0003823 (change log)
Symbol HGNC:MIR449C
DescriptionHomo sapiens miR-449c stem-loop
Gene family MIPF0000133; mir-449
Literature search

69 open access papers mention hsa-mir-449c
(378 sentences)

Stem-loop
      --g       u   gu   c      uu               u 
5' gcu   ggaugug cag  agg agugua  gcuagcggcuguuaa g
   |||   ||||||| |||  ||| ||||||  ||||||||||||||| a
3' cga   cuuacgu guc  ucc ucacgu  ugaucguugacaauu u
      aga       u   uc   -      --               u 
Get sequence
Deep sequencing
5072 reads, 9.62 reads per million, 104 experiments
Confidence Annotation confidence: high
Feedback: Do you believe this miRNA is real?
Comments

This sequence was identified as a miRNA candidate by Berezikov et al. using the RAKE techniques [1]. Expression was later confirmed by Wyman et al. [2].

Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 55172262-55172353 [-]
antisense
OTTHUMT00000313798 ; IL31RA-004; intron 4
OTTHUMT00000214148 ; IL31RA-001; intron 4
OTTHUMT00000313797 ; IL31RA-003; intron 4
OTTHUMT00000313799 ; IL31RA-005; intron 5
OTTHUMT00000313796 ; IL31RA-002; intron 6
ENST00000297015 ; IL31RA-201; intron 3
ENST00000396836 ; IL31RA-004; intron 4
ENST00000447346 ; IL31RA-001; intron 4
ENST00000359040 ; IL31RA-003; intron 4
ENST00000354961 ; IL31RA-202; intron 4
ENST00000490985 ; IL31RA-005; intron 5
ENST00000396834 ; IL31RA-002; intron 6
Clustered miRNAs
< 10kb from hsa-mir-449c
hsa-mir-449cchr5: 55172262-55172353 [-]
hsa-mir-449bchr5: 55170646-55170742 [-]
hsa-mir-449achr5: 55170532-55170622 [-]
Database links

Mature sequence hsa-miR-449c-5p

Accession MIMAT0010251
Previous IDshsa-miR-449c
Sequence

17 - 

uaggcaguguauugcuagcggcugu

 - 41

Get sequence
Deep sequencing4929 reads, 98 experiments
Evidence experimental; RAKE [1], 454 [2]
Database links
Predicted targets

Mature sequence hsa-miR-449c-3p

Accession MIMAT0013771
Previous IDshsa-miR-449c*
Sequence

57 - 

uugcuaguugcacuccucucugu

 - 79

Get sequence
Deep sequencing128 reads, 14 experiments
Evidence experimental; 454 [2]
Predicted targets

References

1
PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2
PMID:19390579 "Repertoire of microRNAs in epithelial ovarian cancer as determined by next generation sequencing of small RNA cDNA libraries" Wyman SK, Parkin RK, Mitchell PS, Fritz BR, O'Briant K, Godwin AK, Urban N, Drescher CW, Knudsen BS, Tewari M PLoS One. 4:e5311(2009).