Stem-loop sequence hsa-mir-4498

AccessionMI0016860 (change log)
Symbol HGNC:MIR4498
DescriptionHomo sapiens miR-4498 stem-loop
Stem-loop
   a   cu gg  --       caagu     --    c 
5'  ggg  g  cu  ggcaggg     gcugc  agau u
    |||  |  ||  |||||||     |||||  ||||  
3'  ccc  c  gg  ccguccc     cgacg  ucug u
   a   -u ua  uu       -----     aa    u 
Get sequence
Deep sequencing
169 reads, 46 reads per million, 63 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 120155434-120155499 [-]
sense
OTTHUMT00000401867 ; CIT-012; intron 2
OTTHUMT00000401848 ; CIT-006; intron 22
OTTHUMT00000401849 ; CIT-007; intron 22
OTTHUMT00000259412 ; CIT-003; intron 23
OTTHUMT00000259410 ; CIT-001; intron 31
OTTHUMT00000401847 ; CIT-005; intron 32
ENST00000544588 ; CIT-012; intron 2
ENST00000392520 ; CIT-006; intron 22
ENST00000537607 ; CIT-007; intron 22
ENST00000545913 ; CIT-003; intron 23
ENST00000261833 ; CIT-001; intron 31
ENST00000392521 ; CIT-005; intron 32
Database links

Mature sequence hsa-miR-4498

Accession MIMAT0019033
Sequence

6 - 

ugggcuggcagggcaagugcug

 - 27

Get sequence
Deep sequencing123 reads, 39 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).