Stem-loop sequence hsa-mir-4496

AccessionMI0016858 (change log)
Symbol HGNC:MIR4496
DescriptionHomo sapiens miR-4496 stem-loop
Stem-loop
   --aca      -  uauaa      aag   c 
5'      ucagcu ca     uccucg   cug c
        |||||| ||     ||||||   |||  
3'      agucga gu     aggagu   gau u
   gggag      a  --caa      aaa   u 
Get sequence
Deep sequencing
74 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 108635810-108635870 [+]
sense
OTTHUMT00000405558 ; WSCD2-003; intron 7
OTTHUMT00000404894 ; WSCD2-001; intron 8
OTTHUMT00000405554 ; WSCD2-002; intron 9
ENST00000549903 ; WSCD2-003; intron 7
ENST00000547525 ; WSCD2-001; intron 8
ENST00000261400 ; WSCD2-201; intron 8
ENST00000332082 ; WSCD2-002; intron 9
Database links

Mature sequence hsa-miR-4496

Accession MIMAT0019031
Sequence

40 - 

gaggaaacugaagcugagaggg

 - 61

Get sequence
Deep sequencing65 reads, 36 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).