Stem-loop sequence hsa-mir-4495

AccessionMI0016857 (change log)
Symbol HGNC:MIR4495
DescriptionHomo sapiens miR-4495 stem-loop
Stem-loop
   a           c               ugga 
5'  agaaauguaaa aggcuuuuugcucag    g
    ||||||||||| |||||||||||||||     
3'  ucuuuacauuu uucgaaaaacgaguu    u
   g           a               uuau 
Get sequence
Deep sequencing
24 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 97939056-97939121 [-]
antisense
OTTHUMT00000407675 ; RMST-004; intron 1
OTTHUMT00000407673 ; RMST-002; intron 6
OTTHUMT00000407671 ; RMST-003; intron 10
ENST00000552411 ; RMST-004; intron 1
ENST00000548886 ; RMST-002; intron 6
ENST00000538559 ; RMST-003; intron 10
Database links

Mature sequence hsa-miR-4495

Accession MIMAT0019030
Sequence

5 - 

aauguaaacaggcuuuuugcu

 - 25

Get sequence
Deep sequencing16 reads, 13 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).