Stem-loop sequence hsa-mir-4494

AccessionMI0016856 (change log)
Symbol HGNC:MIR4494
DescriptionHomo sapiens miR-4494 stem-loop
Stem-loop
   a            -       u ug       aaaauacaa 
5'  guuuuaguuacc cugguca c  cagucug         a
    |||||||||||| ||||||| |  |||||||         a
3'  caaagucaaugg gaccagu g  gucagac         u
   c            a       c gu       cuuaaaagg 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 18 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr12: 47364186-47364269 [-]
intergenic
Database links

Mature sequence hsa-miR-4494

Accession MIMAT0019029
Sequence

52 - 

ccagacuguggcugaccagagg

 - 73

Get sequence
Deep sequencing13 reads, 10 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).