Stem-loop sequence hsa-mir-4493

AccessionMI0016855 (change log)
Symbol HGNC:MIR4493
DescriptionHomo sapiens miR-4493 stem-loop
Literature search

1 open access papers mention hsa-mir-4493
(1 sentences)

Stem-loop
   -c                   ---c     uuau  ca 
5'   cagagaugggaaggccuuc    gguga    ca  g
     |||||||||||||||||||    |||||    ||   
3'   gucucuaccuuuccggaag    ccauu    gu  c
   cu                   accu     -ucc  ac 
Get sequence
Deep sequencing
19 reads, 23.5 reads per million, 17 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 123381440-123381512 [-]
intergenic
Database links

Mature sequence hsa-miR-4493

Accession MIMAT0019028
Sequence

52 - 

agaaggccuuuccaucucugu

 - 72

Get sequence
Deep sequencing16 reads, 15 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).