Stem-loop sequence hsa-mir-4491

AccessionMI0016853 (change log)
Symbol HGNC:MIR4491
DescriptionHomo sapiens miR-4491 stem-loop
Literature search

1 open access papers mention hsa-mir-4491
(10 sentences)

Stem-loop
   aca                        -cg  ga 
5'    uuuggucacaccaguccacauuaa   ug  c
      ||||||||||||||||||||||||   ||  c
3'    aaaccaguguggucagguguaauu   ac  a
   --a                        aua  ag 
Get sequence
Deep sequencing
65 reads, 0 reads per million, 22 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 111347757-111347824 [+]
antisense
OTTHUMT00000391177 ; BTG4-001; intron 5
ENST00000356018 ; BTG4-001; intron 5
Database links

Mature sequence hsa-miR-4491

Accession MIMAT0019026
Sequence

46 - 

aauguggacuggugugaccaaa

 - 67

Get sequence
Deep sequencing56 reads, 21 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).