Stem-loop sequence hsa-mir-4485

AccessionMI0016846 (change log)
Symbol HGNC:MIR4485
DescriptionHomo sapiens miR-4485 stem-loop
Literature search

6 open access papers mention hsa-mir-4485
(11 sentences)

Stem-loop
   ---------  a  c     cu   cagu   a 
5'          ag gg accgc  gcc    gac u
            || || |||||  |||    |||  
3'          uc cc uggcg  cgg    uug g
   acgugucaa  -  a     -c   caau   c 
Get sequence
Deep sequencing
13526 reads, 20.3 reads per million, 153 experiments
Confidence Annotation confidence: low
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr11: 10508270-10508326 [-]
antisense
OTTHUMT00000385783 ; AMPD3-001; intron 5
OTTHUMT00000385785 ; AMPD3-007; intron 5
OTTHUMT00000385787 ; AMPD3-003; intron 5
OTTHUMT00000385788 ; AMPD3-008; intron 5
OTTHUMT00000385789 ; AMPD3-004; intron 5
OTTHUMT00000385790 ; AMPD3-005; intron 5
ENST00000444303 ; AMPD3-201; intron 4
ENST00000396554 ; AMPD3-001; intron 5
ENST00000534047 ; AMPD3-007; intron 5
ENST00000396553 ; AMPD3-003; intron 5
ENST00000529834 ; AMPD3-008; intron 5
ENST00000528723 ; AMPD3-004; intron 5
ENST00000529507 ; AMPD3-005; intron 5
Database links

Mature sequence hsa-miR-4485-5p

Accession MIMAT0032116
Sequence

7 - 

accgccugcccaguga

 - 22

Get sequence
Deep sequencing931 reads, 99 experiments
Evidence not experimental
Database links
Predicted targets

Mature sequence hsa-miR-4485-3p

Accession MIMAT0019019
Previous IDshsa-miR-4485
Sequence

31 - 

uaacggccgcgguacccuaa

 - 50

Get sequence
Deep sequencing12538 reads, 151 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).