Stem-loop sequence hsa-mir-4482-2

AccessionMI0017872 (change log)
DescriptionHomo sapiens miR-4482-2 stem-loop
Stem-loop
   aauaaaaauug     ---u    aa    g    cu          gugg 
5'            aauag    gagc  ccca uggg  auggaaaugu    a
              |||||    ||||  |||| ||||  ||||||||||     
3'            uuauc    cucg  gggu acuc  uaucuuuacg    a
   -caacuacuca     cauu    --    g    uu          guag 
Get sequence
Deep sequencing
43 reads, 0 reads per million, 32 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-4482-5p

Accession MIMAT0019016
Sequence

8 - 

aauugaauagugagcaacccag

 - 29

Get sequence
Deep sequencing18 reads, 18 experiments
Evidence experimental;

References

1
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).