Stem-loop sequence hsa-mir-4482

AccessionMI0016843 (change log)
Previous IDshsa-mir-4482;hsa-mir-4482-1
Symbol HGNC:MIR4482
DescriptionHomo sapiens miR-4482 stem-loop
Stem-loop
   a     caa    g    cu          gugg 
5'  gugag   ccca uggg  auggaaaugu    a
    |||||   |||| ||||  ||||||||||     
3'  cauuc   gggu acuc  uaucuuuacg    a
   c     ucg    g    uu          guag 
Get sequence
Deep sequencing
41 reads, 0 reads per million, 30 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 104268336-104268405 [-]
antisense
OTTHUMT00000050089 ; SUFU-001; intron 1
OTTHUMT00000050092 ; SUFU-004; intron 1
OTTHUMT00000050094 ; SUFU-006; intron 1
ENST00000369902 ; SUFU-001; intron 1
ENST00000369899 ; SUFU-004; intron 1
ENST00000423559 ; SUFU-006; intron 1
Database links

Mature sequence hsa-miR-4482-5p

Accession MIMAT0019016
Sequence

8 - 

aacccagugggcuauggaaaug

 - 29

Get sequence
Deep sequencing18 reads, 18 experiments
Evidence experimental;

Mature sequence hsa-miR-4482-3p

Accession MIMAT0020958
Sequence

44 - 

uuucuauuucucaguggggcuc

 - 65

Get sequence
Deep sequencing18 reads, 12 experiments
Evidence not experimental
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21558790 "Enhancing miRNA annotation confidence in miRBase by continuous cross dataset analysis" Hansen TB, Kjems J, Bramsen JB RNA Biol. 8:378-383(2011).
3
PMID:21785231 "Detection of novel human MiRNAs responding to X-ray irradiation" Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G J Radiat Res. 52:425-432(2011).