Stem-loop sequence hsa-mir-4480

AccessionMI0016841 (change log)
Symbol HGNC:MIR4480
DescriptionHomo sapiens miR-4480 stem-loop
Stem-loop
              u    c     ag   c  ccag 
5' gcagaggugag ugac uccac  ggc ac    g
   ||||||||||| |||| |||||  ||| ||    g
3' ugucuccauuu auug aggug  ccg ug    a
              c    a     aa   a  aaug 
Get sequence
Deep sequencing
16 reads, 100 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr10: 12578753-12578823 [+]
sense
OTTHUMT00000046820 ; CAMK1D-001; intron 1
OTTHUMT00000046822 ; CAMK1D-003; intron 1
OTTHUMT00000046821 ; CAMK1D-002; intron 1
ENST00000378847 ; CAMK1D-001; intron 1
ENST00000487696 ; CAMK1D-003; intron 1
ENST00000378845 ; CAMK1D-002; intron 1
Database links

Mature sequence hsa-miR-4480

Accession MIMAT0019014
Sequence

44 - 

agccaaguggaaguuacuuua

 - 64

Get sequence
Deep sequencing5 reads, 4 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).