Stem-loop sequence hsa-mir-4479

AccessionMI0016838 (change log)
Symbol HGNC:MIR4479
DescriptionHomo sapiens miR-4479 stem-loop
Stem-loop
   gaaaccaag              -     ggaaag 
5'          uccgagcguggcug gcgcg      u
            |||||||||||||| |||||       
3'          aggcucgugccggc cgcgc      u
   accgcgacg              g     aagggc 
Get sequence
Deep sequencing
69 reads, 0 reads per million, 39 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 136886733-136886803 [+]
intergenic
Database links

Mature sequence hsa-miR-4479

Accession MIMAT0019011
Sequence

45 - 

cgcgcggccgugcucggagcag

 - 66

Get sequence
Deep sequencing45 reads, 30 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).