Stem-loop sequence hsa-mir-4477a

AccessionMI0016829 (change log)
Symbol HGNC:MIR4477A
DescriptionHomo sapiens miR-4477a stem-loop
Gene family MIPF0001274; mir-4477
Literature search

2 open access papers mention hsa-mir-4477a
(4 sentences)

Stem-loop
   u         auc                       uuu 
5'  ccuccuccc   aaucacaaauguccuuaauggca   a
    |||||||||   |||||||||||||||||||||||   a
3'  ggaggaggg   uuaguguuuacaggaauuaucgu   g
   u         cac                       uag 
Get sequence
Deep sequencing
174 reads, 3.64 reads per million, 55 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 41233755-41233835 [+]
intergenic
chr9: 63819574-63819654 [-]
intergenic
Clustered miRNAs
< 10kb from hsa-mir-4477a
hsa-mir-4477bchr9: 41233755-41233835 [-]
hsa-mir-4477achr9: 41233755-41233835 [+]
hsa-mir-4477bchr9: 63819574-63819654 [+]
hsa-mir-4477achr9: 63819574-63819654 [-]
Database links

Mature sequence hsa-miR-4477a

Accession MIMAT0019004
Sequence

48 - 

cuauuaaggacauuugugauuc

 - 69

Get sequence
Deep sequencing116 reads, 42 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).