Stem-loop sequence hsa-mir-4476

AccessionMI0016828 (change log)
Symbol HGNC:MIR4476
DescriptionHomo sapiens miR-4476 stem-loop
Stem-loop
   a                   c   ca  cuu  ag 
5'  aaagccugucccuaagucc ucc  gc   cc  a
    ||||||||||||||||||| |||  ||   ||   
3'  uuucggacagggauuuagg agg  cg   gg  g
   g                   a   ac  --u  uu 
Get sequence
Deep sequencing
533 reads, 0 reads per million, 12 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 36893462-36893531 [-]
sense
OTTHUMT00000379558 ; PAX5-015; intron 1
OTTHUMT00000379557 ; PAX5-014; intron 4
OTTHUMT00000379546 ; PAX5-002; intron 6
OTTHUMT00000379548 ; PAX5-006; intron 6
OTTHUMT00000379549 ; PAX5-007; intron 6
OTTHUMT00000379550 ; PAX5-005; intron 6
OTTHUMT00000379551 ; PAX5-008; intron 6
OTTHUMT00000379552 ; PAX5-009; intron 6
OTTHUMT00000379553 ; PAX5-010; intron 6
OTTHUMT00000379555 ; PAX5-013; intron 6
OTTHUMT00000052433 ; PAX5-001; intron 7
OTTHUMT00000379545 ; PAX5-004; intron 7
OTTHUMT00000379547 ; PAX5-003; intron 7
OTTHUMT00000379554 ; PAX5-011; intron 7
OTTHUMT00000379556 ; PAX5-012; intron 7
ENST00000522932 ; PAX5-015; intron 1
ENST00000577752 ; MIR4476-201; exon 1
ENST00000524340 ; PAX5-014; intron 4
ENST00000377840 ; PAX5-002; intron 6
ENST00000523241 ; PAX5-006; intron 6
ENST00000520154 ; PAX5-007; intron 6
ENST00000520281 ; PAX5-005; intron 6
ENST00000446742 ; PAX5-008; intron 6
ENST00000522003 ; PAX5-009; intron 6
ENST00000523145 ; PAX5-010; intron 6
ENST00000414447 ; PAX5-013; intron 6
ENST00000358127 ; PAX5-001; intron 7
ENST00000377853 ; PAX5-004; intron 7
ENST00000377852 ; PAX5-003; intron 7
ENST00000523493 ; PAX5-011; intron 7
ENST00000377847 ; PAX5-012; intron 7
Database links

Mature sequence hsa-miR-4476

Accession MIMAT0019003
Sequence

45 - 

caggaaggauuuagggacaggc

 - 66

Get sequence
Deep sequencing528 reads, 11 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).