Stem-loop sequence hsa-mir-4475

AccessionMI0016827 (change log)
Symbol HGNC:MIR4475
DescriptionHomo sapiens miR-4475 stem-loop
Literature search

1 open access papers mention hsa-mir-4475
(2 sentences)

Stem-loop
   a  uc         g       aaa    u 
5'  uc  aaugagugu ugguucu   ugac c
    ||  ||||||||| |||||||   |||| a
3'  ag  uuacuuacg accaggg   acug u
   a  ua         a       --a    a 
Get sequence
Deep sequencing
28 reads, 0 reads per million, 15 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 36823539-36823599 [-]
sense
ENST00000580479 ; MIR4475-201; exon 1
Database links

Mature sequence hsa-miR-4475

Accession MIMAT0019002
Sequence

37 - 

caagggaccaagcauucauuau

 - 58

Get sequence
Deep sequencing25 reads, 12 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).