Stem-loop sequence hsa-mir-4474

AccessionMI0016826 (change log)
Symbol HGNC:MIR4474
DescriptionHomo sapiens miR-4474 stem-loop
Literature search

1 open access papers mention hsa-mir-4474
(3 sentences)

Stem-loop
   u                           a      uau 
5'  ugccuaccuuguuagucucaugaucag cacaaa   g
    ||||||||||||||||||||||||||| ||||||    
3'  acggauggaacaaucggaguacugguc guguuu   g
   c                           g      cuc 
Get sequence
Deep sequencing
95 reads, 0 reads per million, 31 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr9: 20502265-20502342 [-]
sense
OTTHUMT00000051872 ; MLLT3-001; intron 2
OTTHUMT00000051879 ; MLLT3-008; intron 2
ENST00000579189 ; MIR4474-201; exon 1
ENST00000380338 ; MLLT3-001; intron 2
ENST00000475957 ; MLLT3-008; intron 2
ENST00000429426 ; MLLT3-202; intron 2
ENST00000355930 ; MLLT3-201; intron 2
Database links

Mature sequence hsa-miR-4474-5p

Accession MIMAT0019234
Sequence

13 - 

uuagucucaugaucagacaca

 - 33

Get sequence
Deep sequencing15 reads, 8 experiments
Evidence experimental; Illumina [2-3]
Predicted targets

Mature sequence hsa-miR-4474-3p

Accession MIMAT0019001
Sequence

45 - 

uuguggcuggucaugaggcuaa

 - 66

Get sequence
Deep sequencing80 reads, 27 experiments
Evidence experimental; Illumina [1-3]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:21606961 "Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia" Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML Leukemia. 25:1389-1399(2011).