Stem-loop sequence hsa-mir-4471

AccessionMI0016822 (change log)
Symbol HGNC:MIR4471
DescriptionHomo sapiens miR-4471 stem-loop
Stem-loop
   c                                    aaa 
5'  caaauuuaaaacuuaaaccucuacuaaguuuccaug   a
    ||||||||||||||||||||||||||||||||||||   g
3'  guuuaaauuuugaauuuggagaugauucaaggguac   a
   a                                    cca 
Get sequence
Deep sequencing
22 reads, 0 reads per million, 16 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 100382763-100382845 [+]
sense
OTTHUMT00000379823 ; VPS13B-011; intron 1
OTTHUMT00000277139 ; VPS13B-003; intron 19
OTTHUMT00000277137 ; VPS13B-001; intron 19
OTTHUMT00000277138 ; VPS13B-002; intron 19
ENST00000522802 ; VPS13B-011; intron 1
ENST00000496144 ; VPS13B-003; intron 19
ENST00000357162 ; VPS13B-001; intron 19
ENST00000358544 ; VPS13B-002; intron 19
ENST00000395996 ; VPS13B-201; intron 19
Database links

Mature sequence hsa-miR-4471

Accession MIMAT0018998
Sequence

49 - 

ugggaacuuaguagagguuuaa

 - 70

Get sequence
Deep sequencing17 reads, 12 experiments
Evidence experimental; Illumina [1-2]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).