Stem-loop sequence hsa-mir-4470

AccessionMI0016821 (change log)
Symbol HGNC:MIR4470
DescriptionHomo sapiens miR-4470 stem-loop
Literature search

1 open access papers mention hsa-mir-4470
(4 sentences)

Stem-loop
   c     u          u   -       u  g     
5'  gagcc cuuucggcuu cca guuuguc cg uccu 
    ||||| |||||||||| ||| ||||||| || ||| u
3'  cucgg gagagccgaa ggu caaacgg gc aggu 
   u     -          -   g       u  a     
Get sequence
Deep sequencing
165 reads, 0 reads per million, 62 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr8: 61714788-61714859 [+]
sense
OTTHUMT00000383470 ; CHD7-002; intron 2
OTTHUMT00000383471 ; CHD7-003; intron 5
OTTHUMT00000383468 ; CHD7-001; intron 6
ENST00000524602 ; CHD7-002; intron 2
ENST00000525508 ; CHD7-003; intron 5
ENST00000423902 ; CHD7-001; intron 6
Database links

Mature sequence hsa-miR-4470

Accession MIMAT0018997
Sequence

45 - 

uggcaaacguggaagccgaga

 - 65

Get sequence
Deep sequencing147 reads, 55 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).