Stem-loop sequence hsa-mir-4465

AccessionMI0016816 (change log)
Symbol HGNC:MIR4465
DescriptionHomo sapiens miR-4465 stem-loop
Stem-loop
   -              -  c              ac 
5'  cauguguccccugg ca gcuauuugagguuu  u
    |||||||||||||| || ||||||||||||||   
3'  guacacaggggacc gu ugaugaacuccaag  a
   a              a  c              gu 
Get sequence
Deep sequencing
1 reads, 0 reads per million, 1 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 140683814-140683883 [+]
intergenic
Database links

Mature sequence hsa-miR-4465

Accession MIMAT0018992
Sequence

42 - 

cucaaguagucugaccagggga

 - 63

Get sequence
Deep sequencing1 reads, 1 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).