Stem-loop sequence hsa-mir-4464

AccessionMI0016812 (change log)
Symbol HGNC:MIR4464
DescriptionHomo sapiens miR-4464 stem-loop
Stem-loop
   g   cc                 g                  acag 
5'  gaa  uuaguaagguuuggaua augcaauaaaguaugucc    c
    |||  ||||||||||||||||| ||||||||||||||||||     
3'  cuu  aaucauuccaaaccuau uacguuauuucauacagg    u
   a   --                 g                  aaag 
Get sequence
Deep sequencing
370 reads, 0 reads per million, 11 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 90312742-90312833 [+]
sense
OTTHUMT00000376601 ; ANKRD6-016; intron 1
OTTHUMT00000376596 ; ANKRD6-011; exon 1
OTTHUMT00000376602 ; ANKRD6-017; intron 2
OTTHUMT00000376598 ; ANKRD6-013; exon 3
OTTHUMT00000376599 ; ANKRD6-014; intron 3
OTTHUMT00000376595 ; ANKRD6-010; 3'UTR (exon 3)
OTTHUMT00000041488 ; ANKRD6-001; 3'UTR (exon 4)
OTTHUMT00000041489 ; ANKRD6-002; 3'UTR (exon 4)
OTTHUMT00000376593 ; ANKRD6-005; 3'UTR (exon 4)
OTTHUMT00000376600 ; ANKRD6-015; 3'UTR (exon 4)
OTTHUMT00000376594 ; ANKRD6-006; 3'UTR (exon 4)
OTTHUMT00000041491 ; ANKRD6-004; 3'UTR (exon 4)
OTTHUMT00000376603 ; ANKRD6-018; 3'UTR (exon 4)
OTTHUMT00000041490 ; ANKRD6-003; 3'UTR (exon 5)
ENST00000518150 ; ANKRD6-016; intron 1
ENST00000518253 ; ANKRD6-011; exon 1
ENST00000522779 ; ANKRD6-017; intron 2
ENST00000520886 ; ANKRD6-013; exon 3
ENST00000520458 ; ANKRD6-014; intron 3
ENST00000520793 ; ANKRD6-010; 3'UTR (exon 3)
ENST00000369408 ; ANKRD6-001; 3'UTR (exon 4)
ENST00000339746 ; ANKRD6-002; 3'UTR (exon 4)
ENST00000447838 ; ANKRD6-005; 3'UTR (exon 4)
ENST00000523798 ; ANKRD6-015; 3'UTR (exon 4)
ENST00000522441 ; ANKRD6-006; 3'UTR (exon 4)
ENST00000485637 ; ANKRD6-004; 3'UTR (exon 4)
ENST00000522705 ; ANKRD6-018; 3'UTR (exon 4)
ENST00000465722 ; ANKRD6-003; 3'UTR (exon 5)
antisense
OTTHUMT00000375694 ; LYRM2-003; intron 4
OTTHUMT00000375695 ; LYRM2-004; 3'UTR (exon 4)
ENST00000520897 ; LYRM2-003; intron 4
ENST00000412237 ; LYRM2-004; 3'UTR (exon 4)
Database links

Mature sequence hsa-miR-4464

Accession MIMAT0018988
Sequence

12 - 

aagguuuggauagaugcaaua

 - 32

Get sequence
Deep sequencing362 reads, 9 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).