Stem-loop sequence hsa-mir-4462

AccessionMI0016810 (change log)
Symbol HGNC:MIR4462
DescriptionHomo sapiens miR-4462 stem-loop
Stem-loop
   c      -  ug    --aa        u 
5'  uuccca gc  cccu    gucaggag g
    |||||| ||  ||||    |||||||| g
3'  aagggu cg  ggga    caguccuu c
   a      u  gu    ggca        u 
Get sequence
Deep sequencing
2 reads, 0 reads per million, 2 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr6: 37555365-37555422 [-]
intergenic
Database links

Mature sequence hsa-miR-4462

Accession MIMAT0018986
Sequence

35 - 

ugacacggaggguggcuugggaa

 - 57

Get sequence
Deep sequencing2 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).