Dead miRNA entry

miRNA accession:
MI0016807
miRNA ID:
hsa-mir-4461
Comment:
The pattern of reads from RNAseq experiments does not support the annotation of mir-4461 as a miRNA. The sequence is removed from the database in release 22.

Previous miRNA entry

Stem-loop sequence hsa-mir-4461

AccessionMI0016807 (change log)
Symbol HGNC:MIR4461
DescriptionHomo sapiens miR-4461 stem-loop
Stem-loop
   g           guua g   g      ---agg   ua 
5'  aguaggcuuag    u uac uagucu      cca  c
    |||||||||||    | ||| ||||||      |||  g
3'  ucauccggauc    g aug aucaga      ggu  u
   g           ---g g   -      guuaga   ug 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-4461

Accession MIMAT0018983
Sequence

46 - 

gauugagacuaguagggcuaggc

 - 68

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).