Dead miRNA entry

miRNA accession:
MI0016805
miRNA ID:
hsa-mir-4459
Comment:
The pattern of reads from RNAseq experiments does not support the annotation of mir-4459 as a miRNA. The sequence is removed from the database in release 22.

Previous miRNA entry

Stem-loop sequence hsa-mir-4459

AccessionMI0016805 (change log)
Symbol HGNC:MIR4459
DescriptionHomo sapiens miR-4459 stem-loop
Stem-loop
   a      aggc    ga    --ga    ---  a 
5'  cccagg    ggag  ggug    gguu   gc g
    ||||||    ||||  ||||    ||||   || u
3'  gggucc    ccuc  ucac    cuag   cg g
   g      --ga    ag    ggug    aac  a 
Get sequence
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Database links

Mature sequence hsa-miR-4459

Accession MIMAT0018981
Sequence

3 - 

ccaggaggcggaggagguggag

 - 24

Get sequence
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).