Stem-loop sequence hsa-mir-4457

AccessionMI0016803 (change log)
Symbol HGNC:MIR4457
DescriptionHomo sapiens miR-4457 stem-loop
Stem-loop
   g      u            g        a  a 
5'  gaguac ccagucaauacc ugugaguu ga a
    |||||| |||||||||||| |||||||| || a
3'  cuuaug ggucaguuaugg acacuuaa cu g
   a      c            a        -  c 
Get sequence
Deep sequencing
60 reads, 0 reads per million, 21 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr5: 1309310-1309377 [-]
intergenic
Database links

Mature sequence hsa-miR-4457

Accession MIMAT0018979
Sequence

43 - 

ucacaagguauugacuggcgua

 - 64

Get sequence
Deep sequencing53 reads, 20 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).