Stem-loop sequence hsa-mir-4454

AccessionMI0016800 (change log)
Symbol HGNC:MIR4454
DescriptionHomo sapiens miR-4454 stem-loop
Literature search

7 open access papers mention hsa-mir-4454
(21 sentences)

Stem-loop
   --cc  a  - gagu     -   -  aa 
5'     gg uc c    cacgg cac ca  u
       || || |    ||||| ||| ||  u
3'     cc ag g    gugcc gug gu  u
   acca  -  a aagu     u   c  ac 
Get sequence
Deep sequencing
294115 reads, 458 reads per million, 158 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 163093574-163093628 [-]
intergenic
Database links

Mature sequence hsa-miR-4454

Accession MIMAT0018976
Sequence

3 - 

ggauccgagucacggcacca

 - 22

Get sequence
Deep sequencing294089 reads, 158 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).