Stem-loop sequence hsa-mir-4453

AccessionMI0016799 (change log)
Symbol HGNC:MIR4453
DescriptionHomo sapiens miR-4453 stem-loop
Stem-loop
   --      -  uu      uagc          -----------       gu 
5'   uggaga gc  ggucug    gguuuccuuc           ggggcag  g
     |||||| ||  ||||||    ||||||||||           |||||||  g
3'   acuucu cg  ccggac    ccggaggagg           ccucguc  g
   gg      g  --      ----          aaggaggguuu       ag 
Get sequence
Deep sequencing
66 reads, 0 reads per million, 40 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 152536428-152536516 [+]
sense
OTTHUMT00000365691 ; FAM160A1-003; intron 5
ENST00000505231 ; FAM160A1-003; intron 5
ENST00000435205 ; FAM160A1-201; intron 7
Database links

Mature sequence hsa-miR-4453

Accession MIMAT0018975
Sequence

5 - 

gagcuuggucuguagcgguu

 - 24

Get sequence
Deep sequencing21 reads, 17 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).