Stem-loop sequence hsa-mir-4452

AccessionMI0016798 (change log)
Symbol HGNC:MIR4452
DescriptionHomo sapiens miR-4452 stem-loop
Stem-loop
   u                     g         a u 
5'  ggaucacuugaggccaagagu caaggcugu g g
    ||||||||||||||||||||| ||||||||| |  
3'  ccuagugaauuccgguucuua guuccgaca c u
   c                     a         - g 
Get sequence
Deep sequencing
199 reads, 7.25 reads per million, 69 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 86542482-86542552 [-]
antisense
OTTHUMT00000361826 ; ARHGAP24-013; intron 1
OTTHUMT00000361822 ; ARHGAP24-009; intron 1
OTTHUMT00000252815 ; ARHGAP24-001; intron 2
OTTHUMT00000361753 ; ARHGAP24-003; intron 2
OTTHUMT00000361821 ; ARHGAP24-008; intron 2
ENST00000509709 ; ARHGAP24-013; intron 1
ENST00000512201 ; ARHGAP24-009; intron 1
ENST00000395184 ; ARHGAP24-001; intron 2
ENST00000503995 ; ARHGAP24-003; intron 2
ENST00000506421 ; ARHGAP24-008; intron 2
Database links

Mature sequence hsa-miR-4452

Accession MIMAT0018974
Sequence

46 - 

uugaauucuuggccuuaagugau

 - 68

Get sequence
Deep sequencing19 reads, 16 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).