Stem-loop sequence hsa-mir-4450

AccessionMI0016795 (change log)
Symbol HGNC:MIR4450
DescriptionHomo sapiens miR-4450 stem-loop
Literature search

2 open access papers mention hsa-mir-4450
(2 sentences)

Stem-loop
   u   u      uu  a  ag     ag  cag 
5'  guc ggggau  gg ga  uggug  cg   g
    ||| ||||||  || ||  |||||  ||    
3'  cgg ucccug  cc cu  accac  gu   u
   u   u      gu  c  cu     -g  uuc 
Get sequence
Deep sequencing
84 reads, 0 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 76573568-76573632 [+]
antisense
OTTHUMT00000363059 ; G3BP2-020; intron 1
OTTHUMT00000252401 ; G3BP2-003; intron 8
OTTHUMT00000252400 ; G3BP2-002; intron 9
OTTHUMT00000252399 ; G3BP2-001; intron 9
ENST00000507133 ; G3BP2-020; intron 1
ENST00000357854 ; G3BP2-003; intron 8
ENST00000395719 ; G3BP2-002; intron 9
ENST00000359707 ; G3BP2-001; intron 9
Clustered miRNAs
< 10kb from hsa-mir-4450
hsa-mir-4450chr4: 76573568-76573632 [+]
hsa-mir-548ahchr4: 76575551-76575626 [+]
Database links

Mature sequence hsa-miR-4450

Accession MIMAT0018971
Sequence

5 - 

uggggauuuggagaagugguga

 - 26

Get sequence
Deep sequencing56 reads, 15 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).