Stem-loop sequence hsa-mir-4449

AccessionMI0016792 (change log)
Symbol HGNC:MIR4449
DescriptionHomo sapiens miR-4449 stem-loop
Gene family MIPF0002103; mir-4449
Literature search

3 open access papers mention hsa-mir-4449
(4 sentences)

Stem-loop
   a  --agc     -       gg          g 
5'  gc     ccucg gcggccc  ggggcgggcg c
    ||     ||||| |||||||  ||||||||||  
3'  cg     ggagc cgucggg  cccugcccgu g
   g  gacac     g       -g          g 
Get sequence
Deep sequencing
20367 reads, 943 reads per million, 132 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr4: 52712682-52712747 [+]
sense
OTTHUMT00000361454 ; DCUN1D4-004; intron 1
OTTHUMT00000361456 ; DCUN1D4-006; intron 1
OTTHUMT00000250599 ; DCUN1D4-001; intron 1
OTTHUMT00000250600 ; DCUN1D4-002; intron 1
OTTHUMT00000361457 ; DCUN1D4-007; intron 1
OTTHUMT00000361459 ; DCUN1D4-009; intron 1
OTTHUMT00000361458 ; DCUN1D4-008; intron 1
OTTHUMT00000361460 ; DCUN1D4-010; intron 1
OTTHUMT00000361455 ; DCUN1D4-005; intron 1
OTTHUMT00000250601 ; DCUN1D4-003; intron 1
OTTHUMT00000361461 ; DCUN1D4-011; intron 1
OTTHUMT00000361462 ; DCUN1D4-012; intron 1
OTTHUMT00000361463 ; DCUN1D4-013; intron 1
ENST00000509376 ; DCUN1D4-004; intron 1
ENST00000511675 ; DCUN1D4-006; intron 1
ENST00000334635 ; DCUN1D4-001; intron 1
ENST00000381441 ; DCUN1D4-002; intron 1
ENST00000506673 ; DCUN1D4-007; intron 1
ENST00000504113 ; DCUN1D4-009; intron 1
ENST00000502930 ; DCUN1D4-008; intron 1
ENST00000513800 ; DCUN1D4-010; intron 1
ENST00000507741 ; DCUN1D4-005; intron 1
ENST00000381437 ; DCUN1D4-201; intron 1
ENST00000477560 ; DCUN1D4-003; intron 1
ENST00000509068 ; DCUN1D4-011; intron 1
ENST00000505403 ; DCUN1D4-012; intron 1
ENST00000451288 ; DCUN1D4-202; intron 1
ENST00000504661 ; DCUN1D4-013; intron 1
Database links

Mature sequence hsa-miR-4449

Accession MIMAT0018968
Sequence

39 - 

cgucccggggcugcgcgaggca

 - 60

Get sequence
Deep sequencing533 reads, 80 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).