Stem-loop sequence hsa-mir-4448

AccessionMI0016791 (change log)
Symbol HGNC:MIR4448
DescriptionHomo sapiens miR-4448 stem-loop
Literature search

3 open access papers mention hsa-mir-4448
(26 sentences)

Stem-loop
   a  agug   aaa    aa   ugc         auuau    a 
5'  gg    acc   agac  gag   gagccuucu     gccc g
    ||    |||   ||||  |||   |||||||||     |||| a
3'  cc    ugg   ucug  uuc   cucgggaga     cggg c
   a  guaa   gga    -g   ---         -ccac    a 
Get sequence
Deep sequencing
30832 reads, 59.1 reads per million, 127 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 183886800-183886885 [+]
sense
OTTHUMT00000346187 ; DVL3-004; intron 11
OTTHUMT00000346184 ; DVL3-001; intron 13
OTTHUMT00000346185 ; DVL3-002; intron 13
OTTHUMT00000346333 ; EIF2B5-017; intron 15
ENST00000478247 ; DVL3-004; intron 11
ENST00000313143 ; DVL3-001; intron 13
ENST00000431765 ; DVL3-002; intron 13
ENST00000444495 ; EIF2B5-017; intron 15
Database links

Mature sequence hsa-miR-4448

Accession MIMAT0018967
Sequence

61 - 

ggcuccuuggucuaggggua

 - 80

Get sequence
Deep sequencing30809 reads, 127 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).