Stem-loop sequence hsa-mir-4446

AccessionMI0016789 (change log)
Symbol HGNC:MIR4446
DescriptionHomo sapiens miR-4446 stem-loop
Gene family MIPF0001385; mir-4446
Literature search

2 open access papers mention hsa-mir-4446
(7 sentences)

Stem-loop
   c  gu    u  c      uuc      cuuca 
5'  ug  ccau uc cugcca   ccuugg     a
    ||  |||| || ||||||   ||||||     u
3'  ac  ggua ag gacggu   gggacc     u
   a  ug    c  u      --c      cucau 
Get sequence
Deep sequencing
1750 reads, 1.35 reads per million, 74 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr3: 113594876-113594942 [+]
sense
OTTHUMT00000354747 ; GRAMD1C-015; intron 2
OTTHUMT00000354748 ; GRAMD1C-016; intron 3
OTTHUMT00000354736 ; GRAMD1C-004; intron 4
OTTHUMT00000354733 ; GRAMD1C-001; intron 4
OTTHUMT00000354742 ; GRAMD1C-010; intron 4
OTTHUMT00000354735 ; GRAMD1C-003; intron 4
ENST00000463760 ; GRAMD1C-015; intron 2
ENST00000484714 ; GRAMD1C-016; intron 3
ENST00000452134 ; GRAMD1C-201; intron 3
ENST00000479212 ; GRAMD1C-004; intron 4
ENST00000358160 ; GRAMD1C-001; intron 4
ENST00000486457 ; GRAMD1C-010; intron 4
ENST00000472384 ; GRAMD1C-003; intron 4
Database links

Mature sequence hsa-miR-4446-5p

Accession MIMAT0019233
Sequence

8 - 

auuucccugccauucccuuggc

 - 29

Get sequence
Deep sequencing22 reads, 17 experiments
Evidence experimental; Illumina [2-3]
Predicted targets

Mature sequence hsa-miR-4446-3p

Accession MIMAT0018965
Sequence

43 - 

cagggcuggcagugacaugggu

 - 64

Get sequence
Deep sequencing1728 reads, 67 experiments
Evidence experimental; Illumina [1-3]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).
2
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).
3
PMID:22454130 "Transcription factors are targeted by differentially expressed miRNAs in primates" Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J Genome Biol Evol. 4:552-564(2012).