Stem-loop sequence hsa-mir-4440

AccessionMI0016783 (change log)
Symbol HGNC:MIR4440
DescriptionHomo sapiens miR-4440 stem-loop
Literature search

1 open access papers mention hsa-mir-4440
(1 sentences)

Stem-loop
   c   -   caa      g   ug  g  ug -ug      acc    cu 
5'  ucu cac   gcaagu cag  gg cu  c   gcuugc   guga  c
    ||| |||   |||||| |||  || ||  |   ||||||   ||||  c
3'  aga gug   cguucg guc  uc gg  g   ugaacg   cacu  c
   u   a   uca      -   gu  g  gu cug      aac    cu 
Get sequence
Deep sequencing
124 reads, 0 reads per million, 44 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 239068817-239068914 [-]
antisense
OTTHUMT00000328506 ; FAM132B-005; intron 1
OTTHUMT00000328509 ; FAM132B-008; intron 1
ENST00000486834 ; FAM132B-005; intron 1
ENST00000546354 ; FAM132B-008; intron 1
Database links

Mature sequence hsa-miR-4440

Accession MIMAT0018958
Sequence

65 - 

ugucguggggcuugcuggcuug

 - 86

Get sequence
Deep sequencing105 reads, 38 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).