Stem-loop sequence hsa-mir-4439

AccessionMI0016782 (change log)
Symbol HGNC:MIR4439
DescriptionHomo sapiens miR-4439 stem-loop
Stem-loop
   ---  -a    -                    ----------      
5'    cc  guga cugauaccuuggaggcauuu          uaucu 
      ||  |||| ||||||||||||||||||||          |||| a
3'    gg  cauu gacuauggaaucuccguaaa          auaga 
   acc  ac    u                    cgaaacacac      
Get sequence
Deep sequencing
6 reads, 0 reads per million, 5 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 225010461-225010540 [-]
intergenic
Database links

Mature sequence hsa-miR-4439

Accession MIMAT0018957
Sequence

4 - 

gugacugauaccuuggaggcau

 - 25

Get sequence
Deep sequencing3 reads, 2 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).