Stem-loop sequence hsa-mir-4438

AccessionMI0016781 (change log)
Symbol HGNC:MIR4438
DescriptionHomo sapiens miR-4438 stem-loop
Literature search

1 open access papers mention hsa-mir-4438
(1 sentences)

Stem-loop
   u                                       uugcc 
5'  aaguguaaacuuaaggacugucuuuucuaagccugugcc     u
    |||||||||||||||||||||||||||||||||||||||     u
3'  uucacauuugaauuucugacagaaaagauucggacacgg     u
   c                                       uuucc 
Get sequence
Deep sequencing
16 reads, 138 reads per million, 13 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 213758067-213758159 [+]
antisense
OTTHUMT00000337265 ; AC079610.1-001; intron 3
ENST00000415387 ; AC079610.1-001; intron 3
Database links

Mature sequence hsa-miR-4438

Accession MIMAT0018956
Sequence

56 - 

cacaggcuuagaaaagacagu

 - 76

Get sequence
Deep sequencing4 reads, 3 experiments
Evidence experimental; Illumina [1]
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).