Stem-loop sequence hsa-mir-4437

AccessionMI0016778 (change log)
Symbol HGNC:MIR4437
DescriptionHomo sapiens miR-4437 stem-loop
Stem-loop
   --a        a              a gg 
5'    cuuugugc uuggguccacaagg g  g
      |||||||| |||||||||||||| |  a
3'    gaaacaug gacucggguguucc c  u
   uug        g              - ag 
Get sequence
Deep sequencing
88 reads, 0 reads per million, 14 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 181305593-181305652 [-]
intergenic
Database links

Mature sequence hsa-miR-4437

Accession MIMAT0018953
Sequence

40 - 

ugggcucaggguacaaagguu

 - 60

Get sequence
Deep sequencing84 reads, 10 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:20733160 "Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs" Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI, Blood. 116:e118-e127(2010).