Stem-loop sequence hsa-mir-4436b-1

AccessionMI0017425 (change log)
Previous IDshsa-mir-4436b
Symbol HGNC:MIR4436B1
DescriptionHomo sapiens miR-4436b-1 stem-loop
Gene family MIPF0001236; mir-4436
Literature search

2 open access papers mention hsa-mir-4436b-1
(2 sentences)

Stem-loop
      u                  g            aaaugg    g 
5' gug ccucacuuguccacuucu ccugcccugccc      ugga c
   ||| |||||||||||||||||| ||||||||||||      |||| a
3' uac ggagugaacaggugaaga ggacgggacggg      gcuu g
      c                  a            ----ga    a 
Get sequence
Deep sequencing
50 reads, 7.14 reads per million, 28 experiments
Confidence Annotation confidence: not enough data
Feedback: Do you believe this miRNA is real?
Genome context
Coordinates (GRCh38; GCA_000001405.15) Overlapping transcripts
chr2: 110086433-110086523 [-]
antisense
ENST00000309415 ; SH3RF3-201; intron 8
Database links

Mature sequence hsa-miR-4436b-5p

Accession MIMAT0019940
Sequence

13 - 

guccacuucugccugcccugcc

 - 34

Get sequence
Deep sequencing12 reads, 5 experiments
Evidence experimental; Illumina [1]
Predicted targets

Mature sequence hsa-miR-4436b-3p

Accession MIMAT0019941
Sequence

60 - 

cagggcaggaagaaguggacaa

 - 81

Get sequence
Deep sequencing82 reads, 22 experiments
Evidence experimental; Illumina [1]
Database links
Predicted targets

References

1
PMID:21199797 "Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene" Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C Cancer Res. 71:78-86(2011).